Top

Внутриклеточный ремонт

 

В декабре 2015 года Нобелевская премия по химии была присуждена… биохимикам. Американские ученые Пол Мордрич и Азиз Санкар и шведско-британский биохимик Томас Линдал стали лауреатами самой престижной научной награды за исследование механизмов восстановления ДНК.

В этом решении Нобелевского комитета не было ничего странного. За более чем вековую историю  награждений премию по химии не раз получали и биохимики, и биологи, и даже физики. Удивительно было то, что репарация – восстановление —  ДНК вообще попала в список награждений. Среди учёных бытовало мнение, что Нобелевский комитет никогда не даст премию за репарацию, потому что не сможет выбрать претендентов из множества достойных.

 

Из цикла: Жизнь замечательных идей

 

Вот дом. Он построен из кирпичей.

Вот человек… Или слон. Или  мышь… Любой живой организм. Он тоже построен из своеобразных кирпичей – клеток.

Строительные кирпичи делают из глины, песка, извести и других минеральных материалов. Клетки живого организма «сделаны» из самых различных по составу и сложности молекул органических веществ. Внутри каждой клетки находятся органеллы – крохотные органы, которые выполняют полезную работу, разнообразные клеточные включения и генетический материал в виде молекул ДНК.

Для справки: ДНК –   дезоксирибонуклеиновая кислота — впервые  была выделена в 1869 году швейцарским химиком Иоганном Мишером.

Это макромолекула, которая  состоит из огромного количества одинаковых звеньев. Химический состав этих звеньев был определен в конце XIX – начале XX веков немецким биохимиком Альбрехтом Косселем и американским учёным, выходцем из России Фашелем Левиным.

Они определили, что в составе нуклеиновой кислоты есть фосфорная кислота, сахар (дезоксирибоза) и органические соединения, содержащие атомы азота – основания. Азотистых оснований в ДНК четыре —  аденин, цитозин, гуанин и тимин. Их принято записывать буквами латинского алфавита: А, T, G и C. Аденин всегда образует пару с тимином. Гуанин с цитозином.

 

Комментарий — Константин Северинов: «Молекулы ДНК являются носителем генетической информации, которая записана в виде последовательности букв основания ДНК. Вот эта линейная последовательность из четырёх букв составляет ту поваренную книгу, где написано как сделать, например, человека или мышь».

 

ДНК – цифры и факты

На сегодняшний день все расшифрованные последовательности ДНК составляют сотни тысяч томов, по миллиону знаков в каждом. «Описание» бактерии укладывается в несколько томов. Генетическая энциклопедия человека, его геном – в сотни. Но если мы откроем любой из томов на любой из страниц, то  увидим одинаковый с виду текст, составленный всего лишь из четырех латинских букв AТGС. Примерно вот такой:

ATAATGGCTACCAAGACATAACCTGGCTACCAATTACTATG

 

Если представить себе молекулу ДНК в виде лестницы, то ее вертикальные стойки будут состоять из молекул сахара, кислорода и фосфора, а ступеньки – из двух молекул азотистых оснований: АТ или ГЦ.

 

Комментарий — Константин Северинов: «Язык ДНК состоит из четырёх букв. Но при этом буквы в одной цепи соответствуют буквам в другой цепи. По принципу зеркального отражения.  Или инь-янь, чего-нибудь  такого,  да. Соответственно, разделив две цепочки, можно по каждой из этих цепочек достроить недостающую. И таким образом, вся генетическая информация, которая была в исходном организме, передаётся последующим поколениям. Вот. А сама по себе информация, или этот генетический текст, нужна для того, потому что там кодируются белки».

 

Белки – это молекулы, которые выполняют в нашем организме все виды работ: переносят кислород, формируют ткани, копируют ДНК, занимаются ее ремонтом.

 

Комментарий — Константин Северинов: «ДНК – это поваренная книга, но очень необычная книга. С одной стороны там написано, какой должен быть организм, например, я. Но эта книга не только является  рецептом, это такой хитрый рецепт, который сам себя читает. Сам себя размножает, сам себя чинит, если возникает такая необходимость. Всё очень умно устроено».

 

Молекулы ДНК в каждой клетке ежедневно, ежечасно и даже ежесекундно подвергаются самым разным опасностям. Повредить ДНК могут не только такие безжалостные противники всего живого, как радиация или канцерогены. Но даже самая обычная вода и солнечный свет. Наша планета давно превратилась бы в безжизненную пустыню, если бы не существовало способов «починки» ДНК, воссоздания исходных генетических текстов.

 

Для справки: Механизм, с помощью которого белки сами чинят свою ДНК называется «репарация». От английского слова «repair» — ремонт.

 

Занимаются внутриклеточным ремонтом специальные белковые молекулы – ферменты. У каждого из этих ферментов есть своя специализация. Как и положено в хорошей ремонтной бригаде.

 

Комментарий — Константин Северинов: «Репарация ДНК – это такой очень важный клеточный процесс, который если бы его не было,  его нужно было бы придумать. Реально есть много способов повреждения ДНК, соответственно с этим в клетке есть много различных молекулярных механизмов, молекулярных машин, которые ответственны за исправление тех или других типов повреждений. Тех или других мутаций.  И так как ошибки неизбежны, то хочется их уровень снизить, но до какого-то приемлемого, минимально приемлемого уровня с точки зрения ну, эволюционной. И поэтому есть специальные ферментативные системы, белки, которые тоже закодированы в той самой ДНК, которая призвана эти белки репарировать, то есть, чинить. Эти белки выполняют роль, ну таких что ли корректоров, или редакторов молекулярных. Они буквально бегают по молекуле ДНК, находят те места, которые с их точки зрения неправильные и пытаются залечить эти неправильные места. Вернуть их в исходное, родительское состояние. Вот этот процесс называется репарацией».

 

Изучение системы репарации ДНК началось почти семьдесят лет тому назад.

 

США, Лорел Холлоу, лаборатория Колд Спринг Харбор, 1948 год

В 1948 году молодой микробиолог Альберт Кельнер искал новые антибиотики. И ему для экспериментов были нужны мутантные формы бактерий. Кельнер решил облучать культуры стрептомицетов ультрафиолетовым светом. Тогда уже было известно, что ультрафиолет заставляет ДНК изменяться – мутировать.

 

Комментарий — Константин Северинов: «Аденин, гуанин, цитозин и тимин. Они по природе своей – это ароматические вещества, и поэтому они способны поглощать ультрафиолетовое излучение в тех ситуациях, когда две молекулы тимина, две буквы «Т» находятся рядом друг с дружкой в молекуле ДНК на одной цепи. То с большой вероятностью поглощения кванта ультрафиолетового излучения одним или другим из этих тиминов, они образуют так называемый тиминовый димер. Они сшиваются друг с другом. При попытке репликации, копирования такой молекулы дефект передастся в следующее поколение и может привести к каким-то нежелательным последствиям».

 

Культуры стрептомицетов Кельнер выращивал в стеклянных колбах. Но эксперименты не заладились. Одни культуры росли хорошо, другие гибли. Никакой закономерности в этом не было.

На первый взгляд не было. Но потом Кельнер заметил, что после облучения ультрафиолетом выживают и растут только те бактерии, которые находятся в колбах рядом с окном. И он догадался, что солнечный свет каким-то образом «лечит» облученные бактерии, исправляет повреждения их ДНК.

Это явление позже получило название «фотореактивация» или световая репарация. Оно стало первым изученным процессом восстановления ДНК. Оказалось, что под воздействием яркого видимого света специальный фермент фотолиаза расщепляет димеры тимина. Потом поврежденные участки одной цепи ДНК вырезаются, и на место дыры ставится заплатка по матрице оставшейся «здоровой» цепи.

В 1968 году два американских исследователя Фред Рапп и Пауль Говард-Фландерс предположили, что наряду со световой должна существовать и темновая репарация бактериальных клеток, облученных ультрафиолетом.

 

ДНК – цифры и факты

При облучении бактерий определенной дозой ультрафиолета выживает одна клетка из десяти миллионов. Вспышки света продолжительностью одна миллисекунда достаточно для того, чтобы число выживших бактерий увеличилось в сто тысяч раз.

 

США, Даллас, Университет Техаса, 1971 год

Выпускник медицинского факультета Стамбульского университета Азиз Санкар приехал в США в 1971 и поступил в аспирантуру Университета Техаса в Далласе. Предметом научных исследований молодого ученого была фотолиаза. Тот самый фермент, который помогает бактериям чинить ДНК, поврежденную ультрафиолетом.

Основной проблемой, с которой столкнулся Санкар в своих экспериментах, был дефицит рабочего материала. Потому что природной фотолиазы в бактериях очень мало. И тогда, чтобы облегчить себе работу, Санкар… клонировал фотолиазу!

Изобретенный им метод создания бактериальных «макси-клеток» был совершенно фантастическим. Он позволял производить генно-инженерный белок в любых количествах и изучать его со всех сторон.

В 1977 году изобретатель «макси-клеток» переключился со световой репарации на темновую. Новый этап исследований проходил в Йельском университете.

В то время уже было известно, что тиминовые димеры постепенно исчезают из ДНК даже без «лечебного» действия света. И были известны три UVR-гена, которые отвечали за темновую репарацию: UVR – от английского «UV-resistant», то есть, устойчивые к ультрафиолету. Но как они работают, что происходит в клетке при темновой репарации, оставалось загадкой. Найти ответ мешала та же самая проблема, что и с фотолиазой – малое количество этих белков в клетке.

Санкар пошёл проторенным путем и быстро «наладил производство» новых «белковых продуктов». Вскоре он выяснил, что белковые продукты UVR -генов образуют комплекс, который умеет вырезать испорченный кусок ДНК со «сшитыми» тиминами. Размер этого куска – тринадцать пар оснований. Шесть до и шесть после бракованной пары.

 

Комментарий — Константин Северинов: «Это немножко похоже на то, что вы делаете на старинной печатной машинке. Но вы убираете не только само это место, но и ещё близлежащий к нему участок, а затем по оставшейся здоровой цепочке ДНК вы просто восстанавливаете последовательность».

 

Для справки: Механизм восстановления ДНК, открытый Азизом Санкаром, получил название «Nucleotide  excision repair» — эксцизионная репарация нуклеотидов. «Еxcision» в переводе с английского вырезание или удаление.

 

Эксцизионная репарация нуклеотидов исправляет не больше десяти процентов всех повреждений ДНК. А UVR-гены – не самая наша главная ремонтная бригада. Однако дефекты этого типа репарации вызывают очень тяжелое наследственное заболевание, при котором малейшие пребывание на солнце чревато ожогами и развитием рака кожи.

Ультрафиолет – лишь один из внешних факторов, способных повредить ДНК. Есть еще радиация, канцерогены, другие мутагенные химические вещества. Но самую бОльшую опасность для молекулы ДНК, как это ни странно прозвучит, представляет… сама жизнь. То есть, основные жизненные функции любого живого организма.

Во-первых, дыхание. Мы не можем существовать без кислорода. На кислородном дыхании основан весь наш обмен веществ. Клеточные органеллы митохондрии используют кислород для производства энергии. При этом часть активных форм кислорода повреждает ДНК.

Во-вторых, вода. Это очень активное вещество. При взаимодействии химических веществ, в частности, оснований, с водой может происходить так называемый гидролиз. То есть, разложение с образованием новых соединений. А деться от воды некуда, поскольку мы состоим из неё на шестьдесят процентов.

Первым, кто задумался над повреждениями ДНК в обычных физиологических условиях, был шведский биохимик Томас Линдал.

 

ДНК – цифры и факты

В каждой клетке человеческого тела находятся молекулы ДНК, общая длина которых составляет два метра. Если взять все эти молекулы, размотать их и соединить последовательно, то получится нить длиной восемьдесят миллиардов километров. Эта длина сопоставима с расстоянием восьмикратного полёта от Солнца к Плутону и обратно.

 

Швеция, Каролинский институт, 1968 год

К своим исследованиям Томас Линдал приступил в самом конце шестидесятых годов. Первые же его эксперименты привели к поразительным результатам. Оказалось, что колоссальный ущерб ДНК наносит вода, содержащаяся во всех без исключения тканях. Под её воздействием азотистое основание тимин спонтанно превращается в урацил. В алфавите ДНК буквы «У» вообще нет. Она используется в алфавите другой клеточной молекулы РНК – рибонуклеиновой кислоты.

 

Комментарий — Константин Северинов: И сделать с этим ничего невозможно. Это будет происходить всегда, это происходит в каждом из нас. Во всех вот этих триллионах клеток, из которых мы состоим, это происходит само собой. А такова природа вещей. И порядок вещей, в который сейчас можно не вдаваться,  неизбежное накапливание буквы «У» вместо «Т» в ДНК, которое происходит со временем, и никак не связано с процессом репликации, будет в последующих поколениях приводить к ошибкам. К возникновению мутаций. И в сущности, если бы не было какого-то специального у клетки способа буквы «У» переводить обратно в «Т», то нас бы здесь не было бы. Жизнь не могла бы существовать».

 

Томасу Линдалу удалось отыскать в клетках молекулярного редактора, который исправляет букву У на букву Т. Фермент, открытый Томасом Линдалом, получил название урацил-ДНК-гликозилаза.

 

Комментарий — Константин Северинов: «Если буква «У» в ДНК – это сигнал  тревоги, это что-то неправильное. То, что можно сделать? Нужно найти эти буквы «У» и удалить их. Поставить туда правильную букву. И Фермент Линдаля –урацил-ДНК-гликозилаза – он делает ровно это, он бегает по ДНК, такой молекулярный полицейский, и смотрит, нет ли там неправильной буквы? Как только он её находит, он её убирает. А по матрице родительской цепи вставляет правильную букву. И если такого фермента у нас не было, была бы масса всяких проблем».

 

Для справки: Способ восстановления ДНК, открытый Линдалом, назвали «base excision repair» — эксцизионная репарация оснований. 

 

В 1981 году Томас Линдал переехал в Великобританию, где  возглавил лабораторию Клэр-Холл Лондонского Научно-исследовательского института  рака. Но продолжил заниматься исследованием механизма репарации ДНК у бактерий. И лаборатория, которой он руководил, вскоре стала ведущим центром в этой области.

В 1986-ом году Линдал клонировал ген ДНК-гликозилазы и расшифровал механизм работы этого фермента. В частности, он установил, что гликозилаза выкусывает букву У только из ДНК и не пытается отредактировать РНК, где урацил находится на законных основаниях.

Спустя десять лет, в 1996-м году Томасу Линдалу удалось обнаружить эксцизионную репарацию оснований в клетках человека.

Совсем недавно учёные выяснили, что эта система репарации занимается не только ремонтом ДНК. Наши клетки используют фермент урацил-ДНК-гликозилазу  для борьбы с ВИЧ и онковирусами.

 

ДНК – цифры и факты

В ДНК человека содержится более двадцати тысяч генов. Несколько сот из них мы унаследовали от одноклеточного организма, прародителя всего живого на планете: от бактерии до человека. А примерно восемь процентов генома человека вирусного происхождения.

 

Существуют внешние и внутренние факторы повреждения ДНК. К внешним относятся физико-химические воздействия. Внутренние связаны, в основном, с ошибками при репликации.

 

Для справки: Репликация – это процесс синтеза дочерней молекулы ДНК на матрице родительской молекулы ДНК.

 

Комментарий — Константин Северинов: «Ошибки в  ДНК возникают  во время её репликации. То есть, когда происходит разделение цепей вот этой знаменитой двухцепочечной молекулы ДНК и затем достраивание новых, дочерних цепей по матрицам родительских цепей. В результате, если процесс происходит без ошибок, то должны возникнуть две точные копии родительской молекулы. Вот. Однако на практике – ферменты, белки, которые ответственные за вот эту, процесс репликации, всегда делают ошибки, с какой-то небольшой, но существенной частотой. Если представить себе генетический текст как книгу, то  это будут типичные опечатки. А всякий процесс переписывания книги всегда связан неизбежно с опечатками».

 

Исправлением ошибок, возникающих при переписывании книги, занимается мисматч-репарация. Слово «mismatch» означает неправильная или неподходящая пара, мезальянс. По сути – это механизм, который реагирует на «неравный брак» двух оснований ДНК. Когда аденин, например, образует пару не с тимином, как положено, а с гуанином или цитозином. Если такое происходит, мисматч-репарация разводит неподходящих «партнеров», а затем подбирает им правильную пару.

Мисматч-репарация один из главных специалистов по ремонту ДНК. Поломки этой системы приводят к различным заболеваниям, в частности, к развитию наследственного рака кишечника.

Основной научный вклад в изучение мисматч-репарации внес американский биохимик Пол Модрич.

 

ДНК – цифры и факты

Во время каждого деления клетки человека копируются более чем шесть миллиардов пар нуклеотидов клеточной ДНК. Фермент ДНК-полимераза допускает в среднем триста тысяч «опечаток» на каждое клеточное деление.

 

США, Калифорния, Стэнфордский университет, 1973 год

Когда в начале семидесятых годов американский биохимик Пол Модрич начал изучать мисматч-репарацию ДНК, он находился примерно в той же ситуации, в которой был Азиз Санкар. Учёным были известны три гена, занимающиеся неравными браками между азотистыми основаниями. Но никто понятия не имел, как именно они работают.

 

Комментарий — Константин Северинов: «Когда две цепочки ДНК родительские должны разделиться, потом по матрице каждая из цепочек должна достроить дочернюю цепь. Происходит это в результате действия фермента репликазы, который грубо говоря, берёт отдельные буквы, всего их четыре, и по одной из матриц по цепочке собирает из них недостающую цепочку. И, конечно же, такой фермент  может делать ошибки. Грубо говоря,  он не ту букву вставляет, какую надо. С точки зрения клетки – это очень плохо и нужно исправить. И тут у нас возникает большая проблема. Потому что вы же  не знаете, какая из двух букв неправильная. Да. Или эта или та. Или родительская, или дочерняя. Ну, в общем и целом всё понятно, что с родительской всё нормально, И нужно попытаться каким-то образом идентифицировать дочернюю цепь и исправить ошибку в ней. А не в родительской».

 

Пол Модрич, как и Азиз Санкар, начинал свои исследования с экспериментов над кишечной палочкой. Он открыл и описал основные принципы мисматч-репарации сначала у бактерий, а позже и у человека.

У бактерий проблема идентификации материнской и дочерней цепей ДНК решается просто: специальный фермент ДНК-метилаза вводит в основания А (аденина) метильные группы и таким образом маркирует материнскую цепь.

Можно представить себе эту маркировку, как волшебные чернила, которые видны несколько минут, а потом исчезают. Но этих нескольких минут достаточно, для того чтобы система мисматч-репарации сработала. И отремонтировала дочернюю цепь.

Детали этого процесса в клетках человека гораздо сложнее. Но процесс также начинается  с маркировки материнских цепей. Дальше молекулы одного белка остаются караулить помеченные основания материнской цепи, молекулы другого белка находят неправильно спаренные основания в дочерней цепи. При этом белки-партнеры остаются связанными друг с другом, а участок ДНК между ними превращается в петлю. Потом бракованный участок цепи вырезается и на место бреши ставится заплатка по матрице родительской цепи.

 

Комментарий — Константин Северинов: «И вот Модрич описал процесс. По-английски это называется, ну и по-русски тоже — мисмачепарация То есть, репарация вот таких ошибок включения субстрата, который показывает и описывает, как белки, которыми профессионально занимаются ферменты, этим типом репарации. Как они знают, что нужно залечивать последовательность, используя родительскую цепь в качестве матрицы, а не дочернюю. Вот и решение оказалось и очевидным, и красивым».

 

Мисматч-репарация – одна из наших главных ремонтных бригад. Однако отследить и исправить абсолютно все ошибки, возникающие при репликации ДНК, ей все равно не удается.

Но это и хорошо! Ведь если бы система репарации ДНК работала без сбоев, как идеально отлаженный механизм, наша планета была бы заселена только прямыми потомками и клонами самого первого организма, ДНК которого вечно копировалась бы без единой ошибки.

 

Комментарий — Константин Северинов: «Частота мутаций зависит от организма, на самом деле от размера генома. От количества той генетической информации, которую содержат ДНК того или другого организма, и  вся система эволюции подобрана так, чтобы ошибки были, но их не было слишком много. Поэтому вирусы, у которых геномы маленькие, они при репликации своей ДНК допускают большее количество ошибок, чем,  например, когда происходит репликация нашей ДНК. Но только проблема в том, что, как следствие, в популяции организмов, у которых очень низкий уровень ошибок будет небольшое генетическое разнообразие. Особи все будут очень сильно походить друг на друга с генетической точки зрения. Поэтому если вдруг условия окружающей среды изменятся, то  такая популяция может просто вымереть, потому что не будет каких-то генетических вариантов, которые лучше приспособлены к изменившимся условиям окружающей среды. Остановится эволюция».

 

ДНК – цифры и факты

Последовательность ДНК всех людей на планете совпадает на девяносто девять и девять десятых процента. ДНК человека и шимпанзе идентичны на девяносто девять процентов. С мышами у нас общих целых семьдесят пять процентов ДНК. Бананы, капуста и другие растения — тоже наши родственники, поскольку их ДНК и наша совпадают на пятьдесят процентов.

 

Изучением механизма репарации ДНК уже более полувека занимаются самые разные учёные: химики и биохимики, физики и биологи. А ещё врачи. Ведь эти исследования имеют огромные медицинские перспективы. Точные знания, как работает репарационная система, очень важны для создания новых лекарств против болезней, связанных с повреждениями ДНК. А умение искусственно запускать или, наоборот, выключать процесс репарации в клетках, может помочь в будущем более успешно бороться с онкозаболеваниями.

 

P.S.

12 октября 2008 российский космический корабль Союз привез на Международную орбитальную космическую станцию бесценный груз – небольшой компьютерный диск, на котором были записаны последовательности ДНК самых значимых людей планеты.

По мнению авторов проекта «Бессмертный диск» эти ДНК-коды можно использовать в качестве чертежей или рецептов для возрождения человечества в том случае, если Земля пострадает от какого-нибудь апокалиптического события. И заново заселить нашу планету физиками Стивенами Хокингами, комедиантами Стивенами Колбертами, велогонщиками Лэнсами Армстронгами и… моделями Плейбоя.